Primer Melting Temperature (Tm) Calculator
Paste a primer sequence to estimate its melting temperature.
Your numbers
Your results
Primer Melting Temperature (Tm) Calculator by TheCalcTools
How the Primer Melting Temperature (Tm) Calculator works
For short primers the Wallace rule, Tm = 2 °C per A or T plus 4 °C per G or C, is a quick estimate. For primers of 14 bases or more the basic formula Tm = 64.9 + 41 × (GC − 16.4) ÷ length is used.
These ignore salt and primer concentration. Nearest-neighbour methods used by primer-design software are more accurate; set the annealing temperature about 3 to 5 °C below the Tm and adjust experimentally.
The formula
Worked example
Using the default values shown in the calculator:
| Primer sequence (5′ to 3′) | AGCGGATAACAATTTCACACAGG |
|---|
- The M13 reverse primer (23 bases, 43% GC) has a basic Tm of 53.5 °C.
Result:
| Tm, basic formula (°C) | 53.5 |
|---|---|
| Tm, Wallace rule 2(A+T) + 4(G+C) (°C) | 66.0 |
| GC content | 43.5% |
| Length | 23 |
| Design check | Length 18-25 and GC 40-60%: good |
Frequently asked questions
How close should forward and reverse primer Tms be?
Within about 2 to 5 °C of each other.
Sources and further reading
Related calculators
More in Biology · All calculators
This calculator gives estimates for information only. Check important results independently before you rely on them. See our disclaimer.