GC Content and Sequence Calculator (Reverse Complement)
Paste a DNA or RNA sequence to analyse its GC content and get the reverse complement.
Your numbers
Your results
GC Content and Sequence Calculator (Reverse Complement) by TheCalcTools
How the GC Content and Sequence Calculator (Reverse Complement) works
GC content is the share of bases that are G or C. Higher GC content means more hydrogen bonds and a higher melting temperature.
The reverse complement reads the opposite strand 5′ to 3′: reverse the sequence and swap A↔T and C↔G. Molecular weight uses anhydrous nucleotide masses minus a terminal phosphate correction, a standard estimate for oligos.
The formula
Worked example
Using the default values shown in the calculator:
| Sequence | ATGCGCTAGCTAGGCTTACGATCGTACGCGCATTA |
|---|
- The 35-base example has 51.4% GC.
- Reverse complement: TAATGCGCGTACGATCGTAAGCCTAGCTAGCGCAT.
Result:
| GC content | 51.43% |
|---|---|
| Length (bases) | 35 |
| Base counts | A 8, C 9, G 9, T 9, U 0, other 0 |
| Approx. molecular weight, single strand (g/mol) | 10,747 |
| Reverse complement | TAATGCGCGTACGATCGTAAGCCTAGCTAGCGCAT |
Frequently asked questions
What is a good GC content for PCR primers?
Usually 40% to 60%, with a G or C at the 3′ end.
Sources and further reading
Related calculators
More in Biology · All calculators
This calculator gives estimates for information only. Check important results independently before you rely on them. See our disclaimer.