Biology

DNA to Protein Translation Tool (Codon Translator)

Paste a DNA or RNA coding sequence to see the amino acid sequence.

By TheCalcTools Updated Formula checked and tested

Your numbers

Separate numbers with commas, spaces or new lines. You can paste a column from a spreadsheet.

Your results

Protein (one-letter code, * = stop)
Protein (one-letter code, * = stop)
—
Codons translated
—
Reverse complement (for the other strand)
—

DNA to Protein Translation Tool (Codon Translator) by TheCalcTools

How the DNA to Protein Translation Tool (Codon Translator) works

Each set of three bases (a codon) codes for one amino acid under the standard genetic code. ATG (AUG) is the usual start codon for methionine; TAA, TAG and TGA are stop codons, shown as *.

Frames 2 and 3 start one or two bases later. To read the other strand, translate the reverse complement. Codons containing N or other letters show as X.

The formula

Codon index = 16 × first + 4 × second + third, with T/U = 0, C = 1, A = 2, G = 3

Worked example

Using the default values shown in the calculator:

DNA or RNA sequenceATGGCCATTGTAATGGGCCGCTGAAAGGGTGCCCGATAG
Reading frameFrame 1 (start at base 1)
  1. The example reads MAIVMGR*KGAR*: methionine first, with stop codons after R and at the end.

Result:

Protein (one-letter code, * = stop)MAIVMGR*KGAR*
Codons translated13
Reverse complement (for the other strand)CTATCGGGCACCCTTTCAGCGGCCCATTACAATGGCCAT

Frequently asked questions

Does this find the open reading frame?

No. It translates from the chosen starting base. Look for the first ATG and the next in-frame stop codon to find an ORF.

Sources and further reading

GC Content and Sequence Calculator (Reverse Complement)Paste a DNA or RNA sequence to analyse its GC content and get the reverse complement Primer Melting Temperature (Tm) CalculatorPaste a primer sequence to estimate its melting temperature DNA Copy Number Calculator (ng to Copies)Enter the DNA mass and length to get the number of copies DNA and RNA Concentration Calculator (A260)Enter your A260 reading and dilution to get the concentration and yield Ligation Calculator (Insert to Vector Molar Ratio)Enter vector amount, both lengths and the molar ratio to get the insert mass

More in Biology · All calculators

This calculator gives estimates for information only. Check important results independently before you rely on them. See our disclaimer.